Example Input/Output

Two example sequences follow:

>E01_5_483462.seq Sequence #4 of 95 downloaded on Fri Aug 17 14:34:37 CDT 2007
CAGCGCGCATTACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTG
ATATCCACTGTGGAATTCGCCCTTATATAATTGGATCCGAATTCTTTCTACAACAGCGAGCTAGACGACCAAAAAAAAAC
AATTTCAAACACATGTCCGCTTTCCCGCCACCTCGCTGGATCACTCTCACGTCGCGCCTGTCTCCGTCTCGGTGCACACC
ACGTCGCACATGTCATGTGGTGTTGTGTAGGACGGGGGGGAACAGGATTCCCCGTCAGCAGCTCATAGCCTCGCACTTCA
CAGGGAGAGCGCGGTCGAACGCGCCGCCGCGAGATAATTGCCATTATGGACGAAGAGCGAAAGGGATTCGACGAGCGGCC
GCACTGGCCGTCGTTTTACAAAGGGCGAATTCCACATTGGGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCA
CCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGG
AAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGC
ACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATC
AATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACNTATCTCAGCGATCTGTC
TATTNCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGA 
>A01_1_483458.seq Sequence #0 of 95 downloaded on Fri Aug 17 14:34:37 CDT 2007 
CAGCGCGCATTACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTG
ATATCCACTGTGGAATTCGCCCTTTGTAAAACGACGGCCAGTGCGGCCGCTCGTCGAATCCCGTCCTCTCTTCGTCTATA
ATGGCAATTATCTCCCCCTGCAGTCTTGGACGCAGGGAATACTTGAAACCCCGGCTCCCGATGGATCTCCTCTCTGCTGC
GTAGAAAGAATTCGGATCCAATTATATAAGGGCGAATTCCACATTGGGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGC
GGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGT
GACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGA
GGCCCGCACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTT
TTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG
ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGG
CCCCAGTGCTGCAATGATACCGCGAGANCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAANGG
CCGAGCGCANAANTGGTCCTGCAACTTTAT 
If these sequences contain the MuTIR and the adapter primer, then they are most likely valid Mu insertion sites. The insertion sequences would lie between the two, and this flanking DNA could correspond to a gene that is mutated by the Mu insertion. The sequence consisting of the concatenation of the three is called the fragment

MuTAlyzer searches the input sequences and their reverse complements for the MuTIR and the adapter primers with the allowed number of mismatches to account for sequencing error, highlighting them and reporting the length of the insertion sequences and total fragment lengths in ascending order. The software is designed to always report the MuTIR in the five prime to three prime direction, which may result in the output being the reverse complement of the input. The MuTIR sequence is a consensus sequence that can find any of a large list of different MuTIR sequences. The DNA codes for the MuTIR and the adapter primers are:

TYRTYGAWYCMSBYBSBCTCYTCKTCYATAATVRCAMTTRTCTC

ATATAATTGGATCCGAATTCTTTC

The output for these examples would be as follows, but you can copy and paste the sequences into the tool and see it for yourself as well.


Evaluating the following sequence:

>A01_1_483458.seq Sequence #0 of 95 downloaded on Fri Aug 17 14:34:37 CDT 2007

Insertion site sequence length = 69
Total fragment sequence length = 137

The MuTIR is in blue.
The adapter is in red.
The insertion site is in bold.

CAGCGCGCATTACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTG ATATCCACTGTGGAATTCGCCCTTTGTAAAACGACGGCCAGTGCGGCCGCTCGTCGAATCCCGTCCTCTCTTCGTCTATA ATGGCAATTATCTCCCCCTGCAGTCTTGGACGCAGGGAATACTTGAAACCCCGGCTCCCGATGGATCTCCTCTCTGCTGC GTAGAAAGAATTCGGATCCAATTATATAAGGGCGAATTCCACATTGGGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGC GGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGT GACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGA GGCCCGCACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTT TTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGG CCCCAGTGCTGCAATGATACCGCGAGANCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAANGG CCGAGCGCANAANTGGTCCTGCAACTTTAT


Evaluating the following sequence:

>E01_5_483462.seq Sequence #4 of 95 downloaded on Fri Aug 17 14:34:37 CDT 2007

Insertion site sequence length = 222
Total fragment sequence length = 290

The MuTIR is in blue.
The adapter is in red.
The insertion site is in bold.

TCACGACGGGGAGTCAGGCAACTATGGATGAACGNAATAGACAGATCGCTGAGATANGTGCCTCACTGATTAAGCATTGG TAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA GATCCTTTTTGATAATCTCATGACCAAAATTTAATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGAT GTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCG TAATACGACTCACTATAGGGCGAATTGGAGCTCCCGCGGTGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGCC CAATGTGGAATTCGCCCTTTGTAAAACGACGGCCAGTGCGGCCGCTCGTCGAATCCCTTTCGCTCTTCGTCCATAATGGC AATTATCTCGCGGCGGCGCGTTCGACCGCGCTCTCCCTGTGAAGTGCGAGGCTATGAGCTGCTGACGGGGAATCCTGTTC CCCCCCGTCCTACACAACACCACATGACATGTGCGACGTGGTGTGCACCGAGACGGAGACAGGCGCGACGTGAGAGTGAT CCAGCGAGGTGGCGGGAAAGCGGACATGTGTTTGAAATTGTTTTTTTTTGGTCGTCTAGCTCGCTGTTGTAGAAAGAATT CGGATCCAATTATATAAGGGCGAATTCCACAGTGGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTA CCCAGCTTTTGTTCCCTTTAGTGAGGGTAATGCGCGCTG